Für ein Notebook würde ich ein Originalnetzteil verwenden, weil das Notebook die Ausgangsspannung des Netzteils (in 20 mV Schritten) steuern kann - Stichwort "USB Power Delivery" und "programmable power supply".

Das Originalnetzteil (65 W) liefert laut Aufdruck ...

  • 20 V, 3.25 A
  • 15 V, 3.0 A
  • 9 V, 2.0 A
  • 5 V, 2.0 A

Über die Docking-Station werden sogar 90 W (20 V, 4.5 A) bereitgestellt.

...zur Antwort

Ich frage mich, wie diese "Übereinstimmung" überhaupt ermittelt wird, wenn die Genome bereits völlig unterschiedliche Längen haben.

Banane: 523 Mio. Basenpaare

Mensch: 3.1 Mrd. Basenpaare

... für ein haploides Genom, also "eigentlich" jeweils das Doppelte - nicht etwa wegen des komplementären DNA-Stranges, sondern weil Körperzellen 46 Chromosome enthalten und nicht nur 23 wie Keimzellen.

Wie können da 98 % "übereinstimmen", wenn die Längen schon so unterschiedlich sind?

Außerdem, was bedeutet "übereinstimmen" genau? Dass wir vom "Anfang" lesen und dann Basenpaar für Basenpaar vergleichen? Prinzipiell, wenn ich es wörtlich nehme, kann nach einem "Shift" um ein Basenpaar schon so gut wie überhaupt nichts mehr übereinstimmen.

AGTCAGTCGACAGCGGTAGATCATCGTGTGAG
GAGTCAGTCGACAGCGGTAGATCATCGTGTGA
               ^

Selbst etwas längere / kürzere Telomere müssten somit jegliche "Übereinstimmung" zerstören, obwohl sie phänotypisch keinerlei Auswirkungen haben.

Wenn wir "vergleichen", dann müssen wir schon genau spezifizieren, wie und dann wird es eben interessant.

...zur Antwort

(38 / 100) * 60 = 22.8

Kann man auf 23 Minuten runden oder die selbe Berechnung nochmal für Sekunden machen.

Ich mache das ständig, weil eine Fitness-App, die ich verwende, ebenfalls solche Zeitangaben macht (z. B. 1.98 Stunden). ;-)

...zur Antwort

Die Möglichkeiten, die mir einfallen, sind ...

  • die Duale Berufsausbildung zum Fachinformatiker für Anwendungsentwicklung
  • die Ausbildung zum staatlich geprüften Techniker der Fachrichtung Informatik an einer Berufsfachschule
  • ein Informatikstudium (Bachelor / Master) an einer Fachhochschule oder Universität
...zur Antwort

Worauf möchtest Du hinaus?

In die Richtung, in die die Luftteilchen sich bewegen.

An der Düse: Ins Rohr hinein.

Im Gebläse selbst: Falls es ein Radialgebläse ist, dann tangential zur Rotationsbewegung der Schaufeln.

Allgemein: Dem Druckgradienten folgend.

...zur Antwort

Was möchtest Du denn verkürzen? Eine duale Berufsausbildung?

Sofern es möglich ist, würde ich eine solche immer verkürzen, weil Du in einer solchen oft tatsächlich nicht sooo viel lernst, sondern überwiegend eine billige Arbeitskraft für den Ausbildungsbetrieb bist. Es geht also hauptsächlich darum, am Ende das Zertifikat zu bekommen. Wenn es einen schnelleren Weg dorthin gibt, würde ich diesen immer wählen.

Ich konnte meine Berufsausbildung auf zwei Jahre verkürzen, weil ich bereits das Abitur hatte, und fand das "Niveau" in Berufsschule und Abschlussprüfung doch recht amüsant, weil es nach dem Abitur doch ein deutlicher "Schritt nach unten" war. Im Betrieb hingegen hast Du halt hauptsächlich das gemacht, was Du als Facharbeiter später auch gemacht hättest, nur eben für deutlich weniger Gehalt, weil Du ja noch keinen Abschluss vorweisen konntest. Das würde zumindest ich mir nicht länger antun, als unbedingt nötig. ;-)

Später habe ich dann noch studiert, weil ich mich weiterentwickeln und anspruchsvollere / interessantere Tätigkeiten ausüben wollte, von daher kann ich sagen, dass zwischen Berufsausbildung und Studium wirklich Welten liegen (was aber wohl auch klar sein dürfte).

Eine duale Berufsausbildung würde ich daher immer so schnell wie möglich absolvieren, denn das "ist nix großartiges", das man "zelebrieren" sollte. Es geht eher darum, am Ende ein (natürlich möglichst gutes) Zeugnis zu haben. ;-)

...zur Antwort
Normaler Laptop

Ohne, denn wer will schon auf dem Display "rumgrabbeln" und hinterher Fingerabdrücke entfernen?

Außerdem können Touchscreens auch Defekte haben und für Fehleingaben sorgen, also eine Komponente mehr, die "eine Macke bekommen kann".

"Normales" Touch ist ohnehin viel zu unpräzise. Stifteingabe könnte sinnvoll sein, falls man tatsächlich mal handschriftlich "mitschreiben" möchte.

...zur Antwort
Keine Ahnung 🤷🏻‍♀️

Nein, ich kann es mir nicht vorstellen.

Ich bin ein sehr neugieriger Mensch, von daher wird sich in meinem Leben (hoffentlich) noch vieles verändern und Neues ergeben. :-)

Seit zwei Jahren bin ich wissenschaftlich tätig, aber auch die Möglichkeit einer beruflichen Selbständigkeit steht im Raum.

Auch zuvor bin ich immer möglichst "vielgleisig" gefahren - Berufsausbildung und Studium, Fachhochschule und Universität, Haupt- und Nebenfach. Auch meine Hobbies sind recht unterschiedlich: Sport, Musik, diverse technische Dinge.

Ich habe einige Kontakte ins Ausland, von daher auch keine Idee, ob ich hier bleibe oder wohin es mich mal verschlägt.

Ich würde sagen nichts steht fest. ;-)

Mein Ziel ist es auch eher nicht, nur "einen Weg zu beschreiten", sondern in der begrenzten Zeit, die wir alle auf diesem Planeten haben, möglichst vieles mal ausprobiert / erlebt zu haben, schließlich haben wir nur eine Gelegenheit dafür. ;-)

Von daher gehe ich nicht davon aus, dass ich die nächsten 20 Jahre auf ein Ziel hinarbeiten werde, sondern eher, dass ich möglichst viele verschiedene Dinge tun und möglichst viele verschiedene Erfahrungen sammeln werde. :-)

Außerdem weiß man ja nie, was im Laufe der Zeit alles passiert. Eigentlich hatte ich für 2020 einen Australienaufenthalt geplant. Konnte doch keiner ahnen, dass eine Pandemie dazwischenkommt. ;-)

...zur Antwort

Ja, Du brauchst in aller Regel ein Audio-Interface für diese Mikrofone.

Es gibt ganz einfache Audio-Interfaces, die XLR auf USB "adaptieren".

Ich würde allerdings eines der gängigen Audio-Interfaces nehmen, wie etwa ...

  • Focusrite Scarlett Solo
  • Focusrite Scarlett 2i2
  • Focusrite Scarlett 2i4
  • (Behringer U-Phoria UMC22)
  • Behringer U-Phoria UMC202HD
  • Behringer U-Phoria UMC204HD
  • Steinberg UR12
  • Steinberg UR22

Das UMC22 ist schon recht "schwach", aber evtl. eine Option, falls Du wirklich jeden Euro umdrehen musst.

...zur Antwort

In den alten IBM-Tastaturen sind "buckling spring"-Schalter drin.

https://en.wikipedia.org/wiki/Buckling_spring

Die Schalter, die heutzutage in "mechanischen" Tastaturen verbaut werden, sind grundlegend anders konzipiert, von daher lässt sich da auch nicht wirklich was "vergleichen".

...zur Antwort

Naja, die "Berührung" ist letztlich eine elektrostatische Wechselwirkung zwischen den Elektronen in der Hülle.

Also ja, letztlich interagieren da nur elektrische Felder, wenn man so will. Die Elektronen "krachen natürlich nicht ineinander". ;-)

...zur Antwort

Was soll ein alleiniges "carriage return" (= Wagenrücklauf) tun? Die selbe Zeile überschreiben? Ich glaube nicht, dass jedes Terminal das unterstützt.

Eine neue Zeile bekommst Du mit einem "new line", das die Escape-Sequenz "\n" aufweist.

...zur Antwort

In billigen Headsets sind leider oft keine "richtigen Kabel" (mit einer "richtigen" Ummantelung um die Drahtlitze) drin, sondern lediglich Drahtlitzen, die mit einem isolierenden Lacküberzug versehen worden sind.

Sobald dieser Lack durchgescheuert ist, kommt es zu Kurzschlüssen und damit zu Ausfällen.

Ein Reparaturversuch lohnt sich da oft nicht.

Manchmal sind diese ummantelten Litzen in Wahrheit auch abgespeckte "Koaxialkabel". Das merkst Du daran, dass keine separate Masseleitung vorhanden ist. Das heißt es gibt einen Innenleiter, der das Signal führt, dann eine Lackschicht und darum sind dann weitere Litzen gewickelt, die die Masse führen, dann erneut eine Lackschicht. Bei dieser Konstruktion gezielt die Schirmung oder den Innenleiter zu kontaktieren ist nahezu unmöglich und wenn Du es durchschneidest und zusammenlötest, baust Du natürlich einen Schluss zwischen der inneren und der äußeren Schicht.

...zur Antwort

Kolloquium nach Abschlussarbeit unbenotet?

Ich würde gerne eure Einschätzung zu einer Sache erfahren:

Ich habe meine Abschlussarbeit abgegeben und muss nun in ein Kolloquium, bestehend aus der Präsentation meiner Arbeit, einer Diskussion und der Präsentation des Portfolios. In der Prüfungsordnung stand nichts davon wieviel das Kolloquium zählt. Ich habe im Internet gelesen, dass an manchen Unis das Kolloquium 20-25% in die Abschlussarbeit hinein zählt. Eine Kommilitonin meinte bei ihrer Arbeit wurde einiges bemängelt, was sie aber durch die Diskussion ausgleichen konnte und eine 2 bekam. Das hat sich stark danach angehört, dass das Kolloquium ihre Note verbessert hat. Dann hab ich von meinem Dozenten erfahren, dass die Präsentation meines Portfolios unbenotet bleibt. Auf Nachfragen erklärte er, dass eigentlich nur die Arbeit benotet wird, die Präsentation und Diskussion der Arbeit formal unbewertet bleibt. Sie dient der Verifizierung der Arbeit. Erst danach würde man die Gutachten zusammenführen.

Ich bin nun verwirrt 😑

Hat das Kolloquium überhaupt einen Einfluss auf die Note? Oder ist es eine reine Formalität?

Ich habe eigentlich versucht alle Fragen, die man mir im Kolloquium stellen kann, in der Arbeit zu beantworten. Ich habe daher den Eindruck, ich soll nur noch das runter beten, was ich bereits nieder geschrieben habe.

Oder könnte meine Note sich noch verschlechtern, weil ich keine Ahnung von dem habe, was ich geschrieben habe???

Wie würdet ihr das verstehen?

...zur Frage

Die Verteidigung zählt eigentlich mit zur Arbeit. Erst im Anschluss erhältst Du für Deine Abschlussarbeit eine Note, in die auch die Verteidigung mit einfließt.

Mit der Verteidigung versucht man gewissermaßen herauszufinden, ob Du etwas vom Thema verstehst oder ob Du die Arbeit von einem "Ghostwriter" hast schreiben lassen.

...zur Antwort

Sollte das tatsächlich so sein, dann solltest Du diese "mysteriöse Person" mal fragen, weshalb sie einen Störsender durch die Gegend schleppt.

Ich glaube aber eher nicht an einen kausalen Zusammenhang. ;-)

...zur Antwort

"Leerlaufprozess" ist der Anteil der Zeit, in der Deine CPU "schläft".

96 % Leerlaufprozess bedeutet 4 % Auslastung der CPU.

Wobei diese Prozentangaben bei modernen Prozessoren eher wertlos sind, da diese ihre Taktfrequenz je nach Auslastung verändern.

Wenn ein moderner Prozessor wenig ausgelastet ist, wird er heruntertakten und die Auslastung wird dadurch (anteilig) natürlich wieder höher, weil er mit dem geringeren Takt ja "weniger leisten kann".

Umgekehrt, wenn ein moderner Prozessor stark ausgelastet ist, wird er "übertakten" (TurboBoost), wodurch sich die Auslastung (anteilig) natürlich verringert, weil er mit dem höheren Takt ja "mehr leisten könnte".

...zur Antwort

Weil Du "im Hintergrund" gerade ein Spiel ausführst, das offensichtlich so viel CPU zieht.

...zur Antwort

Sowas macht man clientseitig mittels JavaScript und geeigneter DOM-Manipulationen.

Um es mit PHP zu machen, müsstest Du die Seite neu aufbauen, das dann "sichtbare" Element zusätzlich einfügen (oder eine entsprechende CSS-Eigenschaft setzen) und eine Session verwalten, um zu tracken, für welchen User das Element gerade sichtbar sein soll und für welchen nicht. Das ist total unnötig kompliziert und würde in der Praxis niemand so machen.

...zur Antwort