Sind mRNA und RNA dasselbe? wenn nicht, wo liegt der unterschied?

3 Antworten

es gibt übrigens auch noch rRNA ;) RNA ist der Oberbegriff und ist definiert darurch, dass es ein Einzelstrang ist, indem statt Desoxyribose Ribose vorhanden ist (deswegen R und nicht D) und statt der Base Thymin die Base Uracil eingebaut ist. Unterscheiden tut man dann eben noch z.B. in mRNA, tNRA, rRNA.

LG :)

naja... es gibt verschiedene RNAs: tRNA, mRNA, ka was es sonst noch gibt. mit dem "m"(messenger) spezifiziert du es eben.

nein ist es nicht, mRNA ist die messenger Rna, die wie der Name schon sagt für Proteine codiert (oder so) Wikipedia ist auch hilfreich: "Als mRNA (von engl. messenger RNA), auch Boten-RNA, wird das RNA-Transkript eines zu einem Gen gehörigen Teilabschnitts der DNA bezeichnet. Die mRNA wird bei der Transkription von dem Enzym RNA-Polymerase synthetisiert." Im Gegensatz zu "normalen" RNA, welche sich in Chromosomen verpackt im Zellkern befindet. Außerdem gibt es da noch die tRNA aber ich glaube das musst du nicht lernen. Oder lernt ihr die gesamte Proteinbiosynthese? Wenn du noch ander Fragen hast, kannst du sie mir auch so gerne Stellen.

Grüße und VIel Glück für die Arbeit

Danke, das ist total lieb..:) leider müssen wir die ganze Proteinbiosynthese lernen, aber du hast mir schon sehr geholfen (:

0

Laufrichtung der DNA-Stränge in Bezug auf die Lage der Kohlenstoffatome der Desoxyribose. Transkription?

Hi. Soweit ich das richtig verstanden habe, ist es ja so, dass bei der Transkription beim DNA Strang einer von 5 nach 3 und der andere von 3 nach 5 verläuft. Die mRNA verläuft dann auch vom 5. C-Atom zum 3.In der Replikationsblase wird dann ja die mRNA gebildet oder verstehe ich das falsch? Ich verstehe dabei nur den ganzen Ablauf halt nicht richtig, wie das genau funktioniert, da Bio nicht mein bestes Fach ist. Damit meine ich die Laufrichtung der DNA - Stränge und dem RNA Strang, was genau deren Funktion sind und wie die mRNA dann in der Blase gebildet wird.

Danke im voraus

...zur Frage

Was ist der Unterschied zwischen Energiestoff und Baustoff?

Hey, morgen muss ich Bio Referat abgeben, diese Frage habe ich aber irgendwie noch nicht. Kann mir jemand helfen? LG Louise

...zur Frage

Was passiert bei der Proteinbiosynthese?

Ich muss morgen in Bio einen Vortrag über Ribosome halten, alleridngs habe ich immer noch nicht genau verstanden, was jetzt genau bei der Proteinbiosynthese passiert. Kann mir das jemand mit relativ einfachen Worten erklären? Danke an alle ernst gemeinten Antworten!

...zur Frage

DNA - Abschnitt in Aminosäuresequenz übersetzen?

Hallo :) Ich habe diese Woche Bio-Klausur und bin grad am Lernen, aber leider komme ich bei einer Aufgabe nicht weiter :/ Es geht darum den folgenden DNA-Abschnitt in die Aminosäuresequenz zu übersetzen. Doch um die Aminosäuresequenz zu bekommen, muss ich erstmal die mRNA bilden oder? Der Strang heisst so:

3' CTGGCTACTGACCCGCTTCTTCTATC 5'

jetzt habe ich gedacht ich muss diesen erst in die mRNA umwandeln... und ich habe gedacht der lautet dann so:

5' GACCGATGACTGGGCGAAGAAGATAG 3'

und jetzt noch in die Aminosäuresequenz und da muss ich doch anstatt A in T umzuwandeln A in U umwandeln oder? Oder habe ich da etwas falsch verstanden? Aber da muss dann das Start-Codon AUG vorhanden sein, aber das ist bei mir irgendwie nicht so ^^ Wäre nett wenn ihr mir helfen könntet :) Danke schonmal :)

LG Janiii ;)

...zur Frage

was ist der unterschied zwischen "normale" und bio-eiern?

Hallo :) ich frage mich schon länger, wovon es abhängt ob ein ei ein bio-ei ist,oder nicht,... kann mir da jemand helfen??? liegt es nur am futter, oder auch am platz?

:)

...zur Frage

Reihenfolge von Capping, Polyadenylation, Splicing der RNA

Bin gerade am Repetieren von RNA Processing und habe dabei ein Problem: ich habe mir ganz gross aufgeschrieben, dass die Reihenfolge so geht: 1) Capping 2) Splicing 3) Poly-A hinzufügen. Meine Kollegen haben das alle auch so notiert und auf den Slides sieht es so aus als wäre das richtig. Aber auf mehreren der Slides ist die pre-mRNA dargestellt und hat dort sowhol die Kappe als auch den Poly-A Schwanz aber auch immer noch Introne, von dem her müsst demzufolge das Splicing als letztes passieren... Kann mir jemand dabei helfen?

...zur Frage

Was möchtest Du wissen?