DNA - Abschnitt in Aminosäuresequenz übersetzen?

2 Antworten

Vom Fragesteller als hilfreich ausgezeichnet

Hallo Janii,

als erstes musst Du wissen, ob der DNA-Abschnitt, den Du übersetzen sollst, der codogene oder der Codestrang ist.

.

Ich nehme mal an, es ist der Codogene Strang, dann hast Du ihn bis auf einen Fehler richtig übersetzt: Du musst nämlich in der m-RNA gleich U statt T schreiben. Das ist dann die Transkription.

.

Übersetzt wird dann in der Translation diese m-RNA in die Aminosäuresequenz ab dem Start-Codon AUG, da hast Du völlig recht. Das Start-Codon findest Du dann ab der Position 6 Deiner m-RNA (sobald Du alle T durch U ersetzt hast.

.

Jetzt musst Du nur noch mit Hilfe der genetischen Sonne die Aminosäuren der Reihe nach ablesen.

3

Ich frage mich aber, warum man bei der Übersetzung die komplementären Basen nimmt

0
36
@minervaglass

Naja, wenn du weißt wie die Translation abläuft, dann ist das doch logisch, die t-RNA muss doch mit den komplementären Basen besetzt sein. Capito?

0

Wie gibt man die Aminosäuren an (Codesonne)?

Hallo, also wir behandeln zur Zeit in Biologie die Proteinbiosynthese. Wenn man einen DNA Strang in die Aminosäuresequenz übersetzten will übersetzt man es ja erst in die mRNA und dann mithilfe der codesonne in die Aminosäuresequenz. Da kriegt man dann ja für jedes Triplett sowas wie Ala oder Ser raus. Meine Frage ist jetzt wie man die Aminosäuresequenz dann eigentlich richtig aufschreibt?
Schonmal Danke im Voraus.

...zur Frage

Von DNA zur mRNA?

Ich habe eine Frage zu diesem Strang: 5' CCACTACACCTTAACTGTACGGGGAAGACACATAGT 3' Wie lautet diese DNA- Sequenz als mRNA und wie mach ich das ? Kann mir bitte jemand helfen. Danke im Voraus

...zur Frage

Wie würde man den folgenden DNA-Strang in eine Aminosäuresequenz angeben?

Guten Tag.

Ich bin zur Zeit ein wenig ratlos, was die folgenden Aufgabe betrifft: Ich soll folgenden codogenen DNA-Strang in Aminosäuresequenzen angeben.

5'-CGT TAC CAA TCA TTT GGA AAC AAT ATC TTT-3'

Mir ist schon klar, dass die mRNA wie folgt lauten würde (oder?):

3'-GCA AUG GUU AGU AAA CCU UUG UUA UAG AAA-5'

Jetzt geht die Leserichtung der Ribosomen vom 5' zum 3'-Ende.

Aber wie kann es sein, dass UAG schon das Stopp-Codon darstellt, und AUG das Start-Codon, dass dann irgendwie am Ende der Aminosäurekette stehen würde?

Ich benötige dringend Rat.

Danke!

...zur Frage

DNA BIOLk?

Ich bekam im biolk die aufgabe:

Schreiben Sie den komplementären DNA- Strang zu:

3'-ATT GCC TAA GCA CCG-5'

Waß muss ich da genau tun?

LG

...zur Frage

Codogenen Strang der DNA aus nicht-codogenen herleiten?

Hallo liebe gutefrage.net-Community, ich muss in der Genetik anhand eines nicht-codogenen Strangs den codogenen Strang der DNA ermitteln. Der nicht codogene lautet: 5'ACCATGTATGGGGGCTTCATGTGA3' Ich habe daraus folgenden codogenen Strang gemacht: 3'AUG-AAG-CCC-CCA-UAC-AUG5' Ist das korrekt? Und wie würde nun der codogene Strang von 5'-3', die mRNA und die Anticodons und Aminosäuren der tRNA aussehen? Danke im Voraus für Hilfe

...zur Frage

DNA mRNA Übersetzung?

also erstmal, ich schreibe bald ein Klausur und hab zwei Fragen:

  1. Wenn ich einen ANTISENSE-STrang kriege, dann muss ich den erstmal übersetzen und zwar z.Bsp

DNA - AGCTTA---> m-RNA -UCGAAU- (Thymin wird zu Uracil) die Übersetzung beginnt dann mit dem Stratcodon AUG und endet mit einem Endcodon,ist hier im Beispiel leider nicht vorhanden)

  1. Wenn ich den Sense Strang habe, dann muss ich einfach nur Thymin durch Uracil ersetzen.

AGCTTA---AGCUUA

ist das so richtig? (ich weiß, dass die Übersetzung mit nem Startcodon beginnt und mit einem Stoppcodon endet)

...zur Frage

Was möchtest Du wissen?