Wo befinden sich Promotor und Terminator (Translation)?

1 Antwort

Beides leigt auf dem codogenen Strang, das ist auch entscheidend.

Denn der Promotor gibt die Stelle vor, an der die RNA-Polymerase bindet, es muss also an dem Strang sein, an welchem die RNA-Polymerase auch arbeiten soll.

Der Terminator ist dafür zuständig bzw. daran beteiligt, dass sich die RNA-Polymerase und die synthetisierte mRNA von der DNA lösen, dabei wird eine "Signal-Sequenz" in die mRNA eingebaut, es muss sich daher auch am gleichen (codogenen) Strang befinden.

Was ist ein Promotor und was ist ein Terminator?

Bitte so einfach wie möglich erklären

...zur Frage

Codogener Strang, Sense-Strang, Anti-Sense Strang und Anticodogener Straang?

So ich bin jetzt sehr verwirrt. Ich habe auf mehreren Internetseiten nachgeschaut und irgendwie widersprechen sich diese immer wieder. Auf Wikipedia heißt es der Antisense Strang sei der Codogene Strang, auf einer anderen Seite heißt Codogener Strang sei der Sensestrang. Beide sagen jedoch am Codogenen Strang wird abegelesen bzw. transkribiert (Produkt= mRNA). Wie man sieht ist dort ein Widerspruch. Meine Frage: ist codogene Strang dasselbe wie Sense oder Antisensestrang? 2.) an welchen Strang wir transkribiert?

...zur Frage

Was wird dann mit den Proteinen gemacht?

Transkription und translation habe ich verstanden. Aber was wird dann mit dem synthetisierten Protein gemacht ??

...zur Frage

Komplementärer Strang

Hey, habe nur eine kurze Verständnis Frage.

Wir haben den abzulesenden Strang der DNA als codogenen Strang bezeichnet, und den nicht abzulesenden Strang als nicht-codogenen Strang.

Da ich aber überall komplementärer Strang lese, ist meine Frage nun, ist das der gegenläufer zum codogenen Strang, also in meinem Fall der nicht-codogene Strang?

Danke im Voraus =)

...zur Frage

Wird die mRNA zu tRNA?

Ich weiß dass die mRNA bei der Transkription eine Kopie des codierenden Strangs ist aber was passiert dann bei der translation mit ihr...nennt man sie dann einfach tRNA die dann von den ribosomen „abgelesen“ wird??

...zur Frage

Codogenen Strang der DNA aus nicht-codogenen herleiten?

Hallo liebe gutefrage.net-Community, ich muss in der Genetik anhand eines nicht-codogenen Strangs den codogenen Strang der DNA ermitteln. Der nicht codogene lautet: 5'ACCATGTATGGGGGCTTCATGTGA3' Ich habe daraus folgenden codogenen Strang gemacht: 3'AUG-AAG-CCC-CCA-UAC-AUG5' Ist das korrekt? Und wie würde nun der codogene Strang von 5'-3', die mRNA und die Anticodons und Aminosäuren der tRNA aussehen? Danke im Voraus für Hilfe

...zur Frage

Was möchtest Du wissen?