Frage von impressimo, 25

Codogenen Strang der DNA aus nicht-codogenen herleiten?

Hallo liebe gutefrage.net-Community, ich muss in der Genetik anhand eines nicht-codogenen Strangs den codogenen Strang der DNA ermitteln. Der nicht codogene lautet: 5'ACCATGTATGGGGGCTTCATGTGA3' Ich habe daraus folgenden codogenen Strang gemacht: 3'AUG-AAG-CCC-CCA-UAC-AUG5' Ist das korrekt? Und wie würde nun der codogene Strang von 5'-3', die mRNA und die Anticodons und Aminosäuren der tRNA aussehen? Danke im Voraus für Hilfe

Expertenantwort
von Agronom, Community-Experte für Biologie, 13

Deine genannte Sequenz ist eine RNA Sequenz und wie du auf diese kommst erschließt sich mir nicht ganz, der codogene Strang ist der komplemetäre DNA-Strang. (codogen = antisense; nicht codogen = sense)

Wenn der sense Strang 5'-ACCATGTATGGGGGCTTCATGTGA-3'

So ist der antisense Strang einfach komplemetär dazu, also 3'-TGGTACATACC...-5'

Die mRNA wird an dem antisense Strang aufgebaut, ist also komplementär zum antisense Strang und hat dann wieder die gleiche Sequenz wie der sense Strang, nur eben als RNA, also 5'-ACC-AUG-UAU-GG...-3'

Die Anticodons der tRNA sind dann wieder komplementär zu den mRNA codons, also UGG, UAC, AUA, CC... und welche Aminosäuren das bedeutet kannst du aus einer "codesonne" entnehmen, wie im beigefügten Bild zu sehen.

Dabei liest du es so ab, dass du in der Mitte anfängst, dort ist das 5'-Ende des mRNA codons, das erste codon, also ACC, ergäbe dann die Aminosäure Threonin (Thr), vorausgesetzt davor würde noch ein AUG liegen, ansonsten ginge es erst ab dem nachfolgenden AUG, dann mit Methionin (Met) los.

Keine passende Antwort gefunden?

Fragen Sie die Community