Wodurch entstehen Mutantionen und was bewirken sie?

3 Antworten

Vom Fragesteller als hilfreich ausgezeichnet

Mutationen können ganz verschiedene Ursachen haben und nicht immer ist klar ersichtlich, welches Ereignis diese oder jene Mutation hervorgerufen hat. Es gibt wohl eine genetische Komponente, die das Risiko von Mutationen erhöht oder eben senkt, des Weiteren diverse Umwelteinflüsse wie Strahlung, Ernährung, Temperatur(-schwankungen), krebserregende Substanzen usw. usw. Darüber hinaus unterscheidet man noch zwischen verschiedenen Formen der Mutation, zum Beispiel Punktmutation oder chromosomale Erbgutveränderungen. Übrigens: Nicht jede Variation in deinen Genen zieht auch tatsächlich eine wirksame Veränderung nach sich! Die Gene sind eine Anleitung zum Aufbau von Aminosäuren, die sich wiederum in langen Ketten zu Proteinen zusammenfügen. Wenn eine andere Basenreihenfolge am Ende doch zur gleichen Aminosäure führt, wäre deine DNA zwar mutiert, aber ohne Folgen. Wann sich was verändert, kannst du mithilfe der sogenannten "Code-Sonne" nachvollziehen (--> http://de.wikipedia.org/wiki/Code-Sonne). Viele Grüße!

Mutagen sind überwiegend harte Strahlen (Röntgen / Bestrahlung und Radioaktivität).

Es handelt sich hier um besondere Genmutationen, sog. Rastermutationen. Sie werden z.B. durch die mutagene Substanz Acridin ausgelöst und bestehen darin, dass ein Basenpaar verloren geht (bei Mutation 1 das vierte, damit ist das Gen ab dieser Stelle defekt) bzw. eines eingeschoben wird (bei Doppelmutante eines der letzten). bei der Doppelmutante ist so das Leseraster wieder hergestellt, ab der zweiten Mutation ist das Gen wieder o.k.

Verbesserte Gene weitergeben durch Training?

Beispiel: Ein Mann hat schlechte Gene, in seiner Familie waren die anderen auch eher schmächtig. Nun fängt der Mann an zu trainieren und wird sehr kräftig und muskulös. Würde er nun Kinder bekommen, würden seine Kinder "bessere" Gene bekommen? Oder würde sich da nichts ändern?

...zur Frage

Zweck der Gelelektrophorese

Hey

Ich verstehe die Durchführung der Elektrophorese und dass die Methode der Auftrennung verschieden langer DNA-Abschnitte dient,

aber ich verstehe nicht weshalb man das machen sollte und was ich damit nachweisen oder anfangen kann...

Ich hoffe jemand kann mir das ein bisschen anschaulich erklären :D

Dankeeee

 

...zur Frage

Codogenen Strang der DNA aus nicht-codogenen herleiten?

Hallo liebe gutefrage.net-Community, ich muss in der Genetik anhand eines nicht-codogenen Strangs den codogenen Strang der DNA ermitteln. Der nicht codogene lautet: 5'ACCATGTATGGGGGCTTCATGTGA3' Ich habe daraus folgenden codogenen Strang gemacht: 3'AUG-AAG-CCC-CCA-UAC-AUG5' Ist das korrekt? Und wie würde nun der codogene Strang von 5'-3', die mRNA und die Anticodons und Aminosäuren der tRNA aussehen? Danke im Voraus für Hilfe

...zur Frage

Kann man Krankheiten die durch einen Gendefekt verursacht werden heilen?

Ist es heutzutage möglich ein kaputtes Gen zu "reparieren" oder auszutauschen? Welche Ärzte mache so etwas? Wird damit experimentiert? Wird in Deutschland an so etwas geforscht? Kann man so Krankheiten heilen, die auf einem Gendefekt basieren?

...zur Frage

Wieso können tote Zellen in pflanzl. Geweben eine Funktion übernehmen, aber tier. Gewebe nicht?

...zur Frage

Was möchtest Du wissen?