Warum ist die DNA Träger der Erbanlage?

... komplette Frage anzeigen

4 Antworten

Ich vermute einmal, dass deine Frage darauf abzielt, wie Hershey und Chase ihr Experiment durchgeführt haben, um zu der Erkenntnis zu kommen, dass die DNA Träger des Erbguts ist (siehe dazu die Antwort von HorteCharlus).

Um aber deine eigentliche Frage zu beantworten, warum die DNA sich als Träger der Erbinformation eignet:

Zuallererst einmal, solltest du wissen, wieso überhaupt Proteine und die DNA als Kandidaten gesehen wurden. Beide weisen nämlich die Eigenschaft auf, dass es Makromoleküle sind, die aus mehreren, unterschiedlichen Einzelbausteinen aufgebaut sind (bei Proteinen sind es Aminosäuren, bei der DNA sind es Nucleotide, die die Basen A, T, G und C enthalten). Informationen kann man anhand eines Codes speichern (beim Computer sind es beispielsweise die Abfolgen der Ziffern 0 und 1). Sowohl Proteinbausteine, also auch DNA-Bausteine können also in einen Code verpackt werden:

  • ATTGCGTAGCTAGCTAGAGCTAGA (DNA-Sequenz)
  • GCFTYAGGGAAARNKLIAAAGGED (Proteinsequenz)

Tatsächlich führen die Abfolgen an Aminosäuren zu erheblich größeren Variationen und damit zu viel mehr Möglichkeiten einen Code zu generieren. Dennoch hat die DNA das Rennen um den Träger des Erbguts/der Informationen gewonnen und dafür gibt es Gründe:

Die DNA weißt eine recht einheitliche Struktur auf, während Proteinsequenzen sehr zu abenteuerlichen Strukturen neigen. So ist es zum Einen einfacher Informationen aus der DNA zu lesen. Dann ist die Überlegung hilfreich, welche Makromoleküle zuerst da waren. Und da steht zum anderen die DNA vor der Proteinstruktur. Es gibt eine Hypothese, die besagt, dass das Leben damit anfing, dass alles auf RNA-Basis aufgebaut ist (sog. RNA-Welt-Hypothese). RNA ist strukturell ähnlich aufgebaut wie DNA - nur weniger stabil - was allerdings ein Hinweis ist, dass die DNA früher da war und damit die Position als Erbgutträger eingenommen hat. Erst später haben sich Aminosäuren zu Proteinsequenzen zusammengelagert. Die Information, wie sie sich dabei zusammenlagern, entstammt schließlich aus der DNA. Somit ist die DNA Träger des Erbguts und direkter Vermittler wie Proteine aufgebaut werden. Und um den ersten Schritt zu machen, wie das alles funktioniert,  haben Hershey und Chase diesen Versuch durchgeführt.

LG

Antwort bewerten Vielen Dank für Deine Bewertung

Okay, soweit ich weiß wurden bei diesem Experiment E. coli (Bakterien) mit T2-Phagen befallen. Diese bestehen aus eigentlich nur zwei Komponenten: Einmal ein Protein und aus der DNA (Desoxyribonucleinsäure). Man wollte herausfinden, ob die Erbanlagen im Protein oder in der DNA liegen. Man wollte sozusagen feststellen, ob bei dem Befall der T-Phagen das Protein oder die DNA in die Bakterie hineingeht.;) 

Dafür hat man das Experiment in zwei Teile geteilt. Einmal wurde das Schwefel im Protein, welches nicht in der DNA vorhanden ist, radioaktiv markiert. Die Phagen wurden den Bakterien beigesetzt und das ganze hat man dann zentrifugiert. Dabei setzten die Bakterien sich am Boden ab und anschließend die Radioaktivität gemessen. Das Ergebnis ist negativ, d.h. die Proteinhülle ist außerhalb der Bakterie geblieben.

Daraufhin hat man das Gegenexperiment gemacht. Dafür wurde in der DNA der Phagen radioaktiver Phosphor eingebaut (Phosphor ist in der Proteinhülle nicht enthalten). Nach der Zentrifugierung war in den Bakterien Radioaktivität messbar. Das bedeutet, dass bei dem Befallen die T-Phagen die DNA in die Bakterien "einschleusen", während die Proteinhülle außerhalb bleibt. Damit ist allein die DNA für die Ausbildung neuer Phagen verantwortlich, sie enthält die Erbinformationen (, z. B. welche Aminosäuren in welcher Anzahl und Reihenfolge etc. gebildet werden müssen, um die Proteinhülle der Phagen auszubilden).

Das war jetzt wirklich ganz stark vereinfacht und nicht besonders fachlich, aber es ging ja nur ums Verständnis. Vielleicht ist es ganz gut, wenn du dich ein bisschen mit dem Aufbau der DNA und der Proteine beschäftigst. Spätestens, wenn du dich mit der Proteinbiosynthese und der DNA-Replikation beschäftigt hast, geht dir ein Licht auf.;)

Grüße

Antwort bewerten Vielen Dank für Deine Bewertung

Ja was jetzt?

  • Warum ist die DNA der Träger der Erbanlagen?
  • Warum kann man aus dem Versuch bzw. dem Arbeitsblatt schließen, dass DNA der Träger der Erbanagen ist?
Antwort bewerten Vielen Dank für Deine Bewertung

Die DNA setzt sich aus den 4 Stickstofbasen zusammen, Adenin, Guanin, Thymin, Cytosin. Die Aneinanderreihung der Basen bestimmt den genetischen Code. Die DNA ist also Träger der Erbanlage.

Antwort bewerten Vielen Dank für Deine Bewertung
Kommentar von Silva07
30.09.2016, 10:05

Also ist dieser genetische Code sozusagen die information, die eine Erbanlage ausmacht

0

Was möchtest Du wissen?