Komplementäre Sequenz des DNA Abschnitts fortführen?

Nummer 5. - (Schule, Biologie, Genetik)

1 Antwort

Es "paart" sich immer A mit T und C mit G (und umgekehrt T mit A und G mit C). Darauf weist deine Antwort in Aufgabe 3 auch hin. Bei RNA tritt dann an die Stelle des T ein U.

Zwischen A-T befinden sich 2 Wasserstoff-Brücken (H-Brücken) und zwischen G-C 3 H-Brücken, das ist in der oberen Abbildung auf deinem Arbeitsblatt noch fehlerhaft.

Aufgabe 4 stimmt auch so nicht, du beschreibst dort die "Verpackung" der DNA, mit der Verschlüsselung ist aber etwas anderes gemeint (schaue mal die Translation an).

3

2 Wasserstoffbrücken?? 😅 Wie würde man das zeichnen, weil wir haben letzte Stunde nur ein kleines AB mit ‘nem kleinen Text bekommen

0
35
@itZzMaltee

Wasserstoffbrückenbindungen, sind chemische Bindungen zwischen Moelkülen, in der DNA sorgen sie u.a. dafür, dass sich die zwei komplementären EInzelstränge zu stabilen Doppelsträngen "verbinden" können. Du hast in der Abbildung ja schon 1, 2 und 3 Striche zwischen die Basen gemacht, da gehören eben 2 zwischen A und T oder 3 zwischen G und C hin. Hier nochmal eine Abbildung dazu: www.guidobauersachs.de/genetik/dna.html

0
3

Achsooooooo, ist ja einfach. Aber ich versteh immer noch nicht richtig, wie das bei Aufgabe 5) weitergeht, ist ja nicht gerade regelmäßig. Die Bindungen zwischen A-T und G-C kenne ich ja, aber wieso ist da manchmal doppel T Und neben einem einzelnen G kein C

0
35
@itZzMaltee

Das ist einfach nur eine DNA-Sequenz, es ist nur ein Einzelstrang, du sollst darunter die zugehörigen Basen für den zweiten (komplementären) Einzelstrang schreiben.

Also:

ATTGT...

TAACA...

0
3

Achsooo, ich dachte ich sollte das rechts weiterführen😅. Ist ja ganz einfach also wird aus

ATTGTCCGAACTAATCTGATTGCC

TAACAGGCTTGATTAGACTAACGG

0

Französisch Conditionnel present oder Futur Simple?

Wir haben in der Schule eine Hausaufgabe aufbekommen in Französisch, ich bin in der 9. Klasse und wir benutzen das Cahier d'activites Band 4. Und bin übrigens ein Mädchen, könnte bei der Beantwortung der Fragen hilfreich sein. ;)

 

Die Aufgabenstellung ist:

Conditionnel present ou futur simple? Completez les phrases et dites ce que vous ferez / feriez.

1. S'il fait beau demain, je

2. Si j'etais cuisinier / cuisiniere,

3.Si me parents me donnaient 100 euros;

4. Si mon meilleur ami / ma meilleure amie oubliait mon anniversaire,

5. Si j'ai mon bac dans quelques annees,

 

Kann jemand für mich die Sätze vervollständigen? Das wäre echt lieb weil ich komme damit überhaupt nicht klar! :( Also einfach irgendwas sinnvolles da einsetzen. Wäre total super! :))

...zur Frage

Was möchtest Du wissen?