Hilfe! Biomappe..

2 Antworten

Ich hätte mir einen Deckblatt gestaltet. Dannach hätte ich einen Schülern mit guter Mappe darum gebittet sein Inhaltsverzeichnis vorzulesen. Dabei hätte ich das auf geschrieben. Als Dankeschön hätte ich den Schüler etwas tolles Geschenkt.

Dann hätte ich alle Aufgaben und Arbeitsblätter gemacht die ich aufgeschrieben hätte.

Das wichtige ist auch, alles ordentlich zu machen.

LG

Lulucat10

Lass dir sagen zu welchen Themen ihr Zettel hattet, kopier die Zettel eventuell im Copyshop. Ansonsten suchst du dir zu den jeweiligen Themen Seiten aus dem Internet heraus heftest sie und schreibst das wichtigste aus dem Unterricht handschriftlich auf (frag dafür die anderen). Dann könntest du eventuell noch eine selbstgestellte Aufgabe bearbeiten.

Die Zettel sollten alle gelocht sein und in einer unverknickten Mappe abgeheftet sein.

Vorne oder hinten heftest du noch einen "Geständnistext" ein. Sie wird so oder so merken, dass du keine aktuelle Mappe hast/hattest. Aber tu was um das zu verändern usw. Erst dann kannst du dich auf kommende Arbeiten richtig vorbereiten.

In den Text würde ich schreiben, dass du es bereust, aber nicht rückgängig machen kannst, du dir jetzt viel Mühe gibst das ganze auszugleichen mit dieser Mappe und dass du es in Zukunft besser machen wirst.

Schreib doch mal in welcher Stufe du bist und welches Thema/welche Themen ihr bearbeitet habt. Dann such wenn du magst ich dir ein bisschen was heraus.

Danke, und nochmals danke für das Hilfsangebot, aber nein danke, ich werde schon selber suchen:D auf jeden fall kriegst du dafür ein hilfreichste antwort mark:D

Mit freundlichen grüssen und einen danke

GoG

1

Genetik (klasse 9) frage?

Wir haben in bio das Thema Genetik und sind zum Glück bald durch... ich verstehe nichts... wir haben ein Blatt bekommen und ich lese das gerade so und verstehe einfach nichts. Könnte mir jemand helfen? (Auf dem ersten Bild sieht man die Merkmale, auf dem rechten ist die Aufgabe "mittlere Schwierigkeit")
Danke für alle sinnvollen Antworten!

...zur Frage

Baumtagebuch hilfe zur kastanienbaum

Hallo ich brauche dringend eure Hilfe zum Baumtagebuch zur Kastanienbaum!

April

1.Ich soll ein ast anschauen wie es sich veraendert,wie die Blaetter wachsen. erster beobachtungstag 4 Tage spaeter 8 Tage spaeter.Gibt es dazu Fotos?

...zur Frage

Codogenen Strang der DNA aus nicht-codogenen herleiten?

Hallo liebe gutefrage.net-Community, ich muss in der Genetik anhand eines nicht-codogenen Strangs den codogenen Strang der DNA ermitteln. Der nicht codogene lautet: 5'ACCATGTATGGGGGCTTCATGTGA3' Ich habe daraus folgenden codogenen Strang gemacht: 3'AUG-AAG-CCC-CCA-UAC-AUG5' Ist das korrekt? Und wie würde nun der codogene Strang von 5'-3', die mRNA und die Anticodons und Aminosäuren der tRNA aussehen? Danke im Voraus für Hilfe

...zur Frage

Welche chemsichen Vorgänge passieren in einem Tomatensamen bei der Keimung?

Ich soll ein Protokoll für die Schule anfertigen. Tomatensamen brauchen Licht und Wasser zum Keimen. Aber was passiert da genau? Wäre super wenn mir jemand helfen könnt.

MfG

...zur Frage

Präsentation Biologie "Blutkrebs" Hilfe

Ich und 2 Freundinnen müssen für die schule eine Präsentation über "blutkrebs" machen und dazu noch ein handout. Wir haben uns für ein Wörter suchrätsel entschieden nur brauch ich ein paar Wörter die ich dort verstecken kann. Könnt ihr mir welche nennen?

...zur Frage

Kennt ihr gute wissenschaftliche Bücher zum Thema "Intelligenz"?

Hallo! Ich suche ein gutes wissenschaftliches Buch zum Thema Intelligenz. Mir ist es wichtig, dass vor allem dort die Leistungsfähigkeit oder der IQ in Zusammenhang mit der gehirnstruktur erklärt wird. Also nicht, dass zB Hochbegabte sich schwer "integrieren" können, sondern eher, was bei denen im Kopf anders ist, also der chemische/neuroniologische grund! Ich würde mich sehr über Vorschläge freuen und es wäre auch ganz gut wenn das Buch so halbwegs zu verstehen ist (ich bin 15 und kenne all diese medizinischen Fachbegriffe meistens nicht.) lg

...zur Frage

Was möchtest Du wissen?