Hilfe, Biologie! Codogener Strang & Template Strang?

2 Antworten

Das ist schwierig und wird so viel Diskutiert, da es viele verschiedene Bezeichnungen gibt.

Der codogene Strang ist, wie der Name schon sagt, jener aus dem die mRNA, also die Codons hervorgehen, er wird von der RNA-Polymerase abgelesen. Ein anderer name für diesen Strang ist z.B. "antisense".

Der nicht-codogene Strang wird auch "sense" genannte, da er die gleiche Sequenz wie die mRNA besitzt.

Transkription - Verläuft der codogene Stang immer von 3' nach 5'?

In allen bildlichen Darstellungen der Transkription, die ich bisher gesehen habe, war der codogene Strang derjenige, der von 3' nach 5' verläuft, was ja auch Sinn macht, da die RNA-Polymerase laut Biobuch und Internet immer in 3' -> 5' Richtung liest und in 5' -> 3' Richtung synthetisiert.

Ich frage mich nur, ob nun wirklich immer und ausschließlich der 3' -> 5' Strang codogen ist, oder ob es auch (vielleicht je nach transkribiertem Gen) andersherum sein kann.

Im Internet habe ich bereits recherchiert, allerdings hat jede Webseite diesbezüglich etwas anderes behauptet, was mich ein wenig verwirrt hat.

Vielen Dank. :)

...zur Frage

Welche Funktion hat die DNA ?

Hallo und zwar habe ich einen Text bekommen der mit Fehlern ist. Es handelt sich um die DNA und ich finde irgendwie keine Fehler. Der Text lautet:


DNA erfüllt zwei wesentliche Funktionen. Die Verdopplung der genetischen Information vor jeder Zellteilung wird durch die konservative Replikation erfüllt: Eine Helicase trennt die DNA-Doppelstränge über eine Strecke von 20 Basenpaaren. An die freien Basen eines der beiden Stränge lagern sich kompensatorische Nucleotide an, die durch DNA-Ligase zu einem DNA Strang verknüpft werden. Der neue synthetisierte DNA-Strang wird durch DNA-Replikase zu einem Doppelstrang ergänzt. Für die Herstellung von Proteinen wird die genetische Information an der DNA Abgelesen. Diese Aufgabe erfüllen die Ribosomen. Sie fangen Aminosäuren aus dem Cytoplasma ein und heften sie entsprechend der Basensequenz aneinander. Für jede der 20 Aminosäuren gibt es ein passendes Basentriploid in der DNA.

findet ihr da Fehler? Vielen Dank im Vorraus :)

...zur Frage

Codogener Strang, Sense-Strang, Anti-Sense Strang und Anticodogener Straang?

So ich bin jetzt sehr verwirrt. Ich habe auf mehreren Internetseiten nachgeschaut und irgendwie widersprechen sich diese immer wieder. Auf Wikipedia heißt es der Antisense Strang sei der Codogene Strang, auf einer anderen Seite heißt Codogener Strang sei der Sensestrang. Beide sagen jedoch am Codogenen Strang wird abegelesen bzw. transkribiert (Produkt= mRNA). Wie man sieht ist dort ein Widerspruch. Meine Frage: ist codogene Strang dasselbe wie Sense oder Antisensestrang? 2.) an welchen Strang wir transkribiert?

...zur Frage

Komplementärer Strang

Hey, habe nur eine kurze Verständnis Frage.

Wir haben den abzulesenden Strang der DNA als codogenen Strang bezeichnet, und den nicht abzulesenden Strang als nicht-codogenen Strang.

Da ich aber überall komplementärer Strang lese, ist meine Frage nun, ist das der gegenläufer zum codogenen Strang, also in meinem Fall der nicht-codogene Strang?

Danke im Voraus =)

...zur Frage

Codogenen Strang der DNA aus nicht-codogenen herleiten?

Hallo liebe gutefrage.net-Community, ich muss in der Genetik anhand eines nicht-codogenen Strangs den codogenen Strang der DNA ermitteln. Der nicht codogene lautet: 5'ACCATGTATGGGGGCTTCATGTGA3' Ich habe daraus folgenden codogenen Strang gemacht: 3'AUG-AAG-CCC-CCA-UAC-AUG5' Ist das korrekt? Und wie würde nun der codogene Strang von 5'-3', die mRNA und die Anticodons und Aminosäuren der tRNA aussehen? Danke im Voraus für Hilfe

...zur Frage

Aminosäuren bildung nach DNA-Replikation?

Ich komme etwas durcheinander.. Ich habe mittlerweile die DNA Verdopplung verstanden, jedoch weiß ich jetzt nicht wann die Bildung der Aminosäuren und somit auch die Entstehung der Proteine durch die Aminosäurenkette durch die Basentripletts stattfindet. Wenn die beiden Einzelstränge sich verdoppelt haben und die mRNA gebildet wurde werden dann die beiden neugebildeten Stränge mit dem entstanden komplementären Strang aufgespalten um den DNA code ablesen zu können? Ich hoffe ihr konntet meine Frage verstehen vielen Dank schonmal im Vorraus!

...zur Frage

Was möchtest Du wissen?