Biologie basentriplett-0

2 Antworten

Hey,

wir mussten das nie auswendig lernen, welchen Aminosäuren das entspricht. Wir kriegen immer so eine schöne Code-Sonne. wissen muss man aber:

Adenin paart sich normalerweise (also in der DNA) mit Thymin

Guanin paart sich mit Cytosin

Auf der mRNA gibt es Adenin als Base allerdings nicht - sie ist durch die Base Uracil ersetzt. Thymin ist also komplementär zur Base Uracil.

Wenn du nun also das Basentriplett hast:

AAG (Adenin-Adenin-Guanin),

dann musst du einfach schauen, welche Basen komplementär zu diesen sind:

TTC (Thymin-Thymin-Cytosin)

Ich hoffe ich konnte helfen :)

LG ShD

Zu was wäre dann AUG( Methionin ) komplementär?

1
@amazingworld

Das gibt es doch gar nicht?! Zu Adenin paart sich Thymin, zu Uracil aber auch?! Hast du da irgendwas vertauscht? Sorry, ich bin gerade irritiert...ich äußere mich nochmal morgen dazu, ok?

0

Einfach nur auswendig lernen

musst dir nur merken, dass bei der DNA:

A-T

C-G

und bei der mRNA :

A-U

komplementär sind.

Aber wieso dann TTC? Wieso zweimal TT Und C ist doch garnicht komplementär zu T????

0
@amazingworld

du musst es dir vorstellen wie puzzelteile. Zu einem Puzzleteil A passt gegenüberliegend das Puzzelteil T, zu einem Puzzleteil G passt gegenüberliegend das Puzzleteil C.

das ist dann immer wieder eine Übersetzung:

A-A-G

T-T-C

0
@amazingworld

Also, AAG steht auf der mRNA und TTC auf der DNA

und weil A-T   ( aus TT wird AA)

und weil C-G  ( aus C wird G)

entsteht aus TTC --> AAG

Die Ausnahme ist nur bei Uracil weil wenn A auf der DNA steht, dann steht U in der RNA. Und wenn T auf der DNA steht, dann steht A wie gewohnt auf der RNA.

0

Wie gibt man die Aminosäuren an (Codesonne)?

Hallo, also wir behandeln zur Zeit in Biologie die Proteinbiosynthese. Wenn man einen DNA Strang in die Aminosäuresequenz übersetzten will übersetzt man es ja erst in die mRNA und dann mithilfe der codesonne in die Aminosäuresequenz. Da kriegt man dann ja für jedes Triplett sowas wie Ala oder Ser raus. Meine Frage ist jetzt wie man die Aminosäuresequenz dann eigentlich richtig aufschreibt?
Schonmal Danke im Voraus.

...zur Frage

Genrekombination mithilfe eines Polylinkers (MCS)

Hi, ich habe eine spezielle Frage die sich auf Gentechnik bezieht...

Das Plasmid pUC18 enthält einen Polylinker (auch Multiple Cloning Site = MCS genannt) in einem Markergen namens LacZ, dass die α-Untereinheit der β-Galactosidase codiert. Ein Polylinker ist ein etwa 50 Basenpaare große Sequenz, die mehrere Schnittstellen für Restriktionsenzyme enthält. Bei der Blau-Weiß-Selektion wird ein gewünschtes DNA-Fragment mit dem Plasmid rekombiniert, indem es mit dem gleichen Restriktionsenzym geschnitten wird wie die MCS, sodass (z.B. im Falle von EcoRI) "klebrige Enden" entstehen und somit Plasmid und Insert verknüpft werden können. Die Blau-Weiß-Reaktion dient zum Nachweis, dass das vom Bakterium (z.B. E.coli) aufgenommene Plasmid tatsächlich rekombiniert wurde, da durch die Insertion des DNA Fragments in das LacZ-Gen die Galactosidase als Genprodukt nicht mehr funktionsfähig ist. Daher kann das Substrat der Galactosidase (X-Gal) nicht mehr zu dem blauen Farbstoff 5,5'-Dibrom-4,4'-dichlor-indigo umgewandelt werden, sodass die Kolonien weiß anstatt blau sind.

Meine Frage bezieht sich auf folgendes Problem: Müsste durch den Einbau der MCS in das LacZ-Gen an sich nicht schon das Leseraster des Gens verschoben und somit die Glactosidase funktionslos sein?

Dieses Problem könnte natürlich umgangen werden, wenn die MCS eine Länge hätte, die einem Vielfachen von 3 entspricht und genau zwischen zwei Basentripletts eingebaut würde. Dann würde aber allerdings das Problem bestehen bleiben, dass die Galactosidase ein paar Aminosäuren zu viel besitzt. Bei einer MCS-Länge von 48 Basenpaaren wären das immerhin 16 zusätzliche AS. Das müsste doch zu einem Funktionsverlust führen oder zumindest zu einer Einschränkung der Funktion, je nach dem, wo genau die MCS in das LacZ-Gen eingefügt wurde, oder nicht? Oder gibt es im LacZ-Gen (bzw. in der Galactosidase) eine Stelle, in der eine Insertion von zusätzlichen Basen (bzw. Aminosäuren) keinen Einfluss auf das Protein hat?

Ich würde mich über ein paar hilfreiche Antworten sehr freuen ;-) Vielleicht hab ich auch nur einen Denkfehler oder die ganze Sache falsch verstanden Danke im Voraus!

...zur Frage

Zwei Startcodons in der mRNA?

Hallo! Ich habe eine Frage zu Bio und Mutationen bei der Translation von mRNA: Wo fange ich an, die mRNA zu translatieren, wenn durch eine Mutation zwei Startcodons hervorgerufen wurden? Ist das dann egal oder ist die Mutante überhaupt nicht lebensfähig?

Vielen Dank schon mal für eine Antwort

...zur Frage

Codogenen Strang der DNA aus nicht-codogenen herleiten?

Hallo liebe gutefrage.net-Community, ich muss in der Genetik anhand eines nicht-codogenen Strangs den codogenen Strang der DNA ermitteln. Der nicht codogene lautet: 5'ACCATGTATGGGGGCTTCATGTGA3' Ich habe daraus folgenden codogenen Strang gemacht: 3'AUG-AAG-CCC-CCA-UAC-AUG5' Ist das korrekt? Und wie würde nun der codogene Strang von 5'-3', die mRNA und die Anticodons und Aminosäuren der tRNA aussehen? Danke im Voraus für Hilfe

...zur Frage

Aminosäuren bildung nach DNA-Replikation?

Ich komme etwas durcheinander.. Ich habe mittlerweile die DNA Verdopplung verstanden, jedoch weiß ich jetzt nicht wann die Bildung der Aminosäuren und somit auch die Entstehung der Proteine durch die Aminosäurenkette durch die Basentripletts stattfindet. Wenn die beiden Einzelstränge sich verdoppelt haben und die mRNA gebildet wurde werden dann die beiden neugebildeten Stränge mit dem entstanden komplementären Strang aufgespalten um den DNA code ablesen zu können? Ich hoffe ihr konntet meine Frage verstehen vielen Dank schonmal im Vorraus!

...zur Frage

Was möchtest Du wissen?