Biologie basentriplett-0

2 Antworten

Hey,

wir mussten das nie auswendig lernen, welchen Aminosäuren das entspricht. Wir kriegen immer so eine schöne Code-Sonne. wissen muss man aber:

Adenin paart sich normalerweise (also in der DNA) mit Thymin

Guanin paart sich mit Cytosin

Auf der mRNA gibt es Adenin als Base allerdings nicht - sie ist durch die Base Uracil ersetzt. Thymin ist also komplementär zur Base Uracil.

Wenn du nun also das Basentriplett hast:

AAG (Adenin-Adenin-Guanin),

dann musst du einfach schauen, welche Basen komplementär zu diesen sind:

TTC (Thymin-Thymin-Cytosin)

Ich hoffe ich konnte helfen :)

LG ShD

Zu was wäre dann AUG( Methionin ) komplementär?

1
@amazingworld

Das gibt es doch gar nicht?! Zu Adenin paart sich Thymin, zu Uracil aber auch?! Hast du da irgendwas vertauscht? Sorry, ich bin gerade irritiert...ich äußere mich nochmal morgen dazu, ok?

0

Einfach nur auswendig lernen

musst dir nur merken, dass bei der DNA:

A-T

C-G

und bei der mRNA :

A-U

komplementär sind.

Aber wieso dann TTC? Wieso zweimal TT Und C ist doch garnicht komplementär zu T????

0
@amazingworld

du musst es dir vorstellen wie puzzelteile. Zu einem Puzzleteil A passt gegenüberliegend das Puzzelteil T, zu einem Puzzleteil G passt gegenüberliegend das Puzzleteil C.

das ist dann immer wieder eine Übersetzung:

A-A-G

T-T-C

0
@amazingworld

Also, AAG steht auf der mRNA und TTC auf der DNA

und weil A-T   ( aus TT wird AA)

und weil C-G  ( aus C wird G)

entsteht aus TTC --> AAG

Die Ausnahme ist nur bei Uracil weil wenn A auf der DNA steht, dann steht U in der RNA. Und wenn T auf der DNA steht, dann steht A wie gewohnt auf der RNA.

0

Gemeinsamer Bestandteil aller sauren?

Hey meine Frage wäre, was der gemeinsame Bestandteil aller Säuren ist

...zur Frage

Wie ermittelt man die Basensequenz im Codogenen Strang der DNA?

Das ist keine Hausaufgabe sondern eine reine Interessenfrage! Für die mRNA kann man die Code-Sonne benutzen,um der Aminosäure das entsprechende Basentriplett zuzuordnen.

...zur Frage

Wie gibt man die Aminosäuren an (Codesonne)?

Hallo, also wir behandeln zur Zeit in Biologie die Proteinbiosynthese. Wenn man einen DNA Strang in die Aminosäuresequenz übersetzten will übersetzt man es ja erst in die mRNA und dann mithilfe der codesonne in die Aminosäuresequenz. Da kriegt man dann ja für jedes Triplett sowas wie Ala oder Ser raus. Meine Frage ist jetzt wie man die Aminosäuresequenz dann eigentlich richtig aufschreibt?
Schonmal Danke im Voraus.

...zur Frage

Wie genau manifestiert sich eine rezessive oder dominante Basensequenz?

Wieso kann es sein, dass manche Basensequenzen, Anderen gegenüber dominant vererbt werden und andere wiederrum rezessiv relativ zu anderen? Also, wo genau liegt der Unterschied zwischen ihnen? Bzw. wieso können manche Basensquenzen, Co-Dominat sein und mache nicht? Welcher Mechanismus entscheided darüber wie Basensequenzen verebet werden?

...zur Frage

Codogenen Strang der DNA aus nicht-codogenen herleiten?

Hallo liebe gutefrage.net-Community, ich muss in der Genetik anhand eines nicht-codogenen Strangs den codogenen Strang der DNA ermitteln. Der nicht codogene lautet: 5'ACCATGTATGGGGGCTTCATGTGA3' Ich habe daraus folgenden codogenen Strang gemacht: 3'AUG-AAG-CCC-CCA-UAC-AUG5' Ist das korrekt? Und wie würde nun der codogene Strang von 5'-3', die mRNA und die Anticodons und Aminosäuren der tRNA aussehen? Danke im Voraus für Hilfe

...zur Frage

Aminosäuren bildung nach DNA-Replikation?

Ich komme etwas durcheinander.. Ich habe mittlerweile die DNA Verdopplung verstanden, jedoch weiß ich jetzt nicht wann die Bildung der Aminosäuren und somit auch die Entstehung der Proteine durch die Aminosäurenkette durch die Basentripletts stattfindet. Wenn die beiden Einzelstränge sich verdoppelt haben und die mRNA gebildet wurde werden dann die beiden neugebildeten Stränge mit dem entstanden komplementären Strang aufgespalten um den DNA code ablesen zu können? Ich hoffe ihr konntet meine Frage verstehen vielen Dank schonmal im Vorraus!

...zur Frage

Was möchtest Du wissen?