Frage von iwqiwqjfiqwfs, 134

Wie übersetzt man DNA in MRNA?

Kann mir jemand den DNA- Strang 3' TACGTATGAACACCCATCAATGCG 5' in einen MRNA Strang übersetzen? Ich weiß zwar, dass es etwas mit 3' und 5' zu tun hat, jedoch habe ich keine Ahnung was. Eine zusätzliche Erklärung wäre auch nett.

Antwort
von LenaandScholly, 109

Du brauchst immer die entsprechend passende base also bei cytisin guanin. Außerdem wird bei der RNA Thymin durch urasil ersetzt Beispiel: TAC => AUG

Kommentar von MausMitGebiss ,

Uracil

Antwort
von MausMitGebiss, 102

Meinst du die Frage ernst? Sowas weiß man nur dann nicht, wenn man quasi noch nie in seinem Leben etwas mit Genetik am Hut hatte.... wenn das bei dir der Fall ist, helfe ich dir gerne.... Ich glaube, dass die Übersetzung von DNA in mRNA weltweit eine der ersten Übungen ist, die man überhaupt lernt, wenn man über Genetik spricht.

Kommentar von iwqiwqjfiqwfs ,

Ja, ist ernst

Kommentar von MausMitGebiss ,

Okay... also da ich gerade super wenig Zeit habe, übersetzt ich erstmal den Strang.... die Erklärung kommt später.

3' TACGTATGAACACCCATCAATGCG 5'
5' AUGCAUACUUGUGGGUAGUUACGC 3'

Die Stränge sehen nur wegen der Breite der Buchstaben ungleich lang aus... 


Kurzerklärung: Während der Bildung der mRNA werden die Basen der DNA folgendermaßen übersetzt:

Das Gegenstück zu A ist U

 Gegenstück von T ist A

 Gegenstück von G ist C

Gegenstück C ist G


Ich hoffe, mir ist oben kein Flüchtigkeitsfehler unterlaufen... aber selbst wenn, weißt du jetzt, wie du ihn finden kannst.

Kommentar von iwqiwqjfiqwfs ,

Ja ist richtig.

Keine passende Antwort gefunden?

Fragen Sie die Community

Weitere Fragen mit Antworten