Frage von Galaxyman20, 53

Leseraster in der mRNA und das Startcodon?

Guten Abend,

letztens im Biologieunterricht verursachte eine Aufgabe in der ganzen Klasse Verwirrung. Und zwar haben wir eine mRNA-Basensequenz die wie folgt lautet:

5' GACCGAUGACUGGGCGAAGAAGAUAG 3' mit dem Startcodon AUG.

Die erste Aufgabe lautete, die Aminosäuren zu bestimmen, die von diesem Abschnitt codiert werden. Kein Problem dachte ich mir, einfach ab dem Startcodon AUG eine Einteilung in Dreierschritte machen und dann auf die Codesonne schauen.

Die nächste Aufgabe lautete jedoch die erste Base nach dem Start wegfallen zu lassen. Hierbei habe ich einfach das A nach AUG entfernt und bekam neue Aminosäuren. Das Lösungsbuch sah jedoch vor, die erste Base des gesamten Stranges (G) zu entfernen, was eine Verschiebung der Dreier-Einteilung verursachen würde und somit kein Startcodon mehr vorhanden wäre.

Doch dies erschließt sich mir nicht ganz, bisher dachte ich immer die Dreier-Einteilung beginnt sowieso erst ab dem Startcodon AUG, egal welche Basen sich davor befinden, anders hätte auch die vorherige Aufgabe zu keinem Ergebnis geführt.

Daher meine Frage:

Beginnt die Einteilung in Basentripletts bereits an dem 5'-Ende des Stranges oder erst ab dem Startcodon AUG?

Wenn es nur eins von beiden ist, würden sich die beiden Aufgaben ja widersprechen.

Entschuldigung für die lange Frage und vielen Dank im Voraus.

Expertenantwort
von Agronom, Community-Experte für Biologie, 53

Also ich kann dir zumindest so viel sagen, dass die Tripletts nur zwischen dem Start und Stopp Codon zu finden sind. Davor und dahinter haben die Sequenzen ganz andere Funktionen (z.B. für Regulation der Translation und strukturelle Stabilität des RNA-Stranges) und sind demnach auch nicht in 3er Basenabschnitten angeordnet.

Daher kann ich auch die Aufgabe bzw. die genannte Lösung des Lösungsheftes nicht wirklich nachvollziehen.

Keine passende Antwort gefunden?

Fragen Sie die Community