Frage von hannler, 45

Hilfe! Morgen Biotest!?

hey leute :) wir haben heute in Bio einen Zettel bekommen mit zwei Aufgaben kann mir jmd n´bitte diese beantworten?

  1. Ermittle die Aminosäurensequenz, die in folgendem DNA- Abschnitt codiert ist. Ergänze dazu zunächst den komplimentären DNA- Strang. Beschrifte dein Ergebnis mit den Fachbegriffen Codogen und Codon.

3´CGGTATAGCCGGGGTAAAGCAATTGCCTAGAATAAA 5´

  1. Prüfe wie die DNA- Sequenz zu er folgenden Aminosäuresequenz aussehen könnte.

    Met- His- His- Pro- Val- Ser

bitte helft mir schnell ich wäre euch sehr dankbar!!!

Antwort
von theantagonist18, 26

Komplementär bedeutet gegenläufig zu dem Strang, den du da hast. Also jedem C ist ein G gegenüber und jedem T ein A und andersherum natürlich.

Von links wäre es also 5'GCCATAT.....3'

Bei der nächsten Aufgabe musst du nur nachschauen welches Basentriplett für welche Aminosäure codiert und diese Tripletts dann aneinander hängen.

Kommentar von hannler ,

und was ist codogen und ein codon ??

Kommentar von theantagonist18 ,

Ein Basentriplett auf der mRNA, das für eine Aminosäure codiert ist ein Codon. Und ein Codogen ist ein Basentriplett auf der DNA, das für ein komplementäres Triplett auf der mRNA codiert

Keine passende Antwort gefunden?

Fragen Sie die Community

Weitere Fragen mit Antworten