Frage von singinbird, 46

Bio: Transkription von DNS in mRNS-Strang übersetzen!?

Hilfe ! Heut Abend steht eine Bio-Klausur an und ich hänge an dieser Übungsufgabe komplett fest:

Forscher haben bei einer Spinne diesen Ausschnitt aus dem CODIERENDEN STRANG der DNS isoliert:

3' CAAGTGTCTCATTAACGAGAGTACCATG 5'

übersetzen Sie den Strang in seinen dazugehörigen

a) codogenen DNS Strang b) mRNS-Strang

So, jetzt finde ich nirgendwo was konkretes, wie ich den codierenden (das Wort taucht sowieso fast nirgends auf) in den codogenen Strang übersetzen kann ! Muss ich dafür die Buchstaben austauschen (T=A, A=T oder sonswie) UND auch die Richtung in 5' zu 3' ? Den codogenen Strang müsste ich ja dann problemlos in mRNS übersetzen können, indem ich T durch U austausche; aber wie ist das dann wieder mit der Richtung ? Hilfe, ich bin richtig richtig aufgeschmissen :(

Antwort
von yiyaa, 27

Nur die Ruhe das ist gar nicht so kompliziert:

Der Codogene Strang wird vom 3' zum 5' Ende abgelesen. Dieser Codierende Strang oder Code Strang der Forscher ist dasselbe was bei der kopie, also wie bei der mRNA. Der einzige Unterschied bei der mRNA ist, dass du statt Thymin (T) Uracil (U) hast. Also für die mRNA einfach den Codierenden Strang abschreiben und T durch U ersetzten.Beim Codogenen Strang nimmst du einfach die komplementären Basen und tauschst 3' und 5' Ende, also du schreibst quasi einfach den anderen Teil der DNS auf

Einigermaßen verstanden? Sonst kann ichs nochmal ausführlicher versuchen :D

Kommentar von yiyaa ,

ich kann dir zum besseren verständnis den ansatz sagen: 

a) 5' GTTCA.................3'

b) 3' CAAGUGU.........5'

Kommentar von singinbird ,

du bist der einzige im ganzen internet, wo ichs jetzt einigermaßen verstanden hab ! danke schonmal dafür !
Eine frage habe ich allerdings noch:
also für die mRNA schreib ich einfach den angegebenen Strang ab und ersetze natürlich T durch U .. aber was ist mit dem codogenen ? Fang ich von HINTEN an (von 5') und arbeite mich nach vorne (in richtung 3') vor und ersetze dabei die Basen durch ihre Gegenstücke ? Freue mich mega über eine Antwort !

Kommentar von yiyaa ,

Soweit ich weiß ist das beim aufschreiben egal, die Richtung spielt nur bei der Transkription ne Rolle weil nur vom 5' zum 3' Ende angeknüpft werden kann also muss die DNA immer erst ein bisschen aufgehen, dass sich die mRNA bilden kann.

Der codogene Strang wird von der (ich glaube polymerase?) vom 3' zum 5' abgelesen du kannst das einfach auch so machen, aber im Prinzip ist beim hinschreiben die Richtung egal am Ende steht ja eh das gleiche da :P

Ich kann mal schauen ob ich dir ein Bild machen kann, dann ist es vielleicht besser verständlich :D

Keine passende Antwort gefunden?

Fragen Sie die Community

Weitere Fragen mit Antworten